baxa

Ensembl ID:
ENSDARG00000020623
ZFIN ID:
ZDB-GENE-000511-6
Description:
bcl2-associated X protein, a [Source:RefSeq peptide;Acc:NP_571637]
Human Orthologue:
BAX
Human Description:
BCL2-associated X protein [Source:HGNC Symbol;Acc:959]
Mouse Orthologue:
Bax
Mouse Description:
BCL2-associated X protein Gene [Source:MGI Symbol;Acc:MGI:99702]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6041 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011691 Nonsense 20 192 2 6

The following transcripts of ENSDARG00000020623 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 37776347)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37639707
KASP Assay ID:
554-3873.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGTTCTCTATAAYTCTGTAGGCAGTGGCAATGACCAGATACTTGACT[T/A]GGGAGCTGCACTTCTCAACAAGTGAGTATTATTTTTATCTCCCCTTNCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link