ap1b1

Ensembl ID:
ENSDARG00000020621
ZFIN IDs:
ZDB-GENE-030131-6932, ZDB-GENE-061025-1, ZDB-GENE-061025-1, ZDB-GENE-061025-1
Description:
AP-1 complex subunit beta-1 [Source:RefSeq peptide;Acc:NP_001122002]
Human Orthologue:
AP1B1
Human Description:
adaptor-related protein complex 1, beta 1 subunit [Source:HGNC Symbol;Acc:554]
Mouse Orthologue:
Ap1b1
Mouse Description:
adaptor protein complex AP-1, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1096368]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18117 Nonsense Available for shipment Available now
sa20411 Essential Splice Site Mutation detected in F1 DNA During 2015
sa26468 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa18117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022518 Nonsense 70 947 3 21
ENSDART00000137128 Nonsense 70 947 4 22
ENSDART00000140042 Nonsense 70 125 4 5
Genomic Location:
Chromosome 5 (position 26472413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTCAACTGCATGCAGACAGAKAACCTGGAACTGAAAAAGCTGGTCTA[T/A]CTGTACTTGATGAATWATGCCAAGAGCCAGCCAGACATGGCCATTATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022518 Essential Splice Site 353 947 7 21
ENSDART00000137128 Essential Splice Site 353 947 8 22
ENSDART00000140042   None 125 None 5
Genomic Location:
Chromosome 5 (position 26465310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCTGGATATAATGATCCGCCTGGCCTCTCAGGCCAACATTGCTCAGG[T/C]AAACACATTACACATATGGATGCTCTTAAGTTAAAGTTTTGGAATGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022518 Nonsense 861 947 19 21
ENSDART00000137128 Nonsense 861 947 20 22
ENSDART00000140042   None 125 None 5
Genomic Location:
Chromosome 5 (position 26439268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAGTGTTTTTGGCCACCTGGAAGGACATCCCAAATGACAACGAGGCA[C/T]AGTTCCAAATCAAAGACGTACACCTCAACTCAGGTAATGGGAATAAATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2jlgacvj