ap1b1

Ensembl ID:
ENSDARG00000020621
ZFIN IDs:
ZDB-GENE-030131-6932, ZDB-GENE-061025-1, ZDB-GENE-061025-1, ZDB-GENE-061025-1
Description:
AP-1 complex subunit beta-1 [Source:RefSeq peptide;Acc:NP_001122002]
Human Orthologue:
AP1B1
Human Description:
adaptor-related protein complex 1, beta 1 subunit [Source:HGNC Symbol;Acc:554]
Mouse Orthologue:
Ap1b1
Mouse Description:
adaptor protein complex AP-1, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1096368]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18117 Nonsense Available for shipment Available now
sa20411 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022518 Nonsense 70 947 3 21
ENSDART00000137128 Nonsense 70 947 4 22
ENSDART00000140042 Nonsense 70 125 4 5
Genomic Location:
Chromosome 5 (position 26472413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTCAACTGCATGCAGACAGAKAACCTGGAACTGAAAAAGCTGGTCTA[T/A]CTGTACTTGATGAATWATGCCAAGAGCCAGCCAGACATGGCCATTATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022518 Essential Splice Site 353 947 7 21
ENSDART00000137128 Essential Splice Site 353 947 8 22
ENSDART00000140042 None None 125 None 5
Genomic Location:
Chromosome 5 (position 26465310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCTGGATATAATGATCCGCCTGGCCTCTCAGGCCAACATTGCTCAGG[T/C]AAACACATTACACATATGGATGCTCTTAAGTTAAAGTTTTGGAATGAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2jlgacvj