si:ch211-160d20.3

Ensembl ID:
ENSDARG00000020611
ZFIN ID:
ZDB-GENE-030131-8906
Description:
hypothetical protein LOC692267 [Source:RefSeq peptide;Acc:NP_001038706]
Human Orthologue:
C19orf47
Human Description:
chromosome 19 open reading frame 47 [Source:HGNC Symbol;Acc:26723]
Mouse Orthologue:
2310022A10Rik
Mouse Description:
RIKEN cDNA 2310022A10 gene Gene [Source:MGI Symbol;Acc:MGI:1913617]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36695 Nonsense Mutation detected in F1 DNA During 2017
sa23345 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004129 Nonsense 169 405 6 8
ENSDART00000123264 Nonsense 137 171 5 5
Genomic Location (Zv9):
Chromosome 18 (position 35133612)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36812768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGCCCAGCAAACCAGCTGAAGAAAATGGATTGCAAGTGAAGCGCAGA[C/T]GAGTCACTAGAGAAATGGAAGGGAAATACATCATAAACATGCCAAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004129 Nonsense 204 405 7 8
ENSDART00000123264   None 171 None 5
Genomic Location (Zv9):
Chromosome 18 (position 35136411)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36815567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTGATGTCTTCTCATAATGTCCACTTTCATTACCACAGCCAAGGTTT[T/A]AAAGCGTACTTCAGTTTTTGACAGACTTGGGGCAGAGTCTAAAGCAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link