tnnt2a

Ensembl ID:
ENSDARG00000020610
ZFIN IDs:
ZDB-GENE-000626-1, ZDB-GENE-000626-1
Description:
troponin T2a, cardiac [Source:RefSeq peptide;Acc:NP_690853]
Human Orthologue:
TNNT2
Human Description:
troponin T type 2 (cardiac) [Source:HGNC Symbol;Acc:11949]
Mouse Orthologue:
Tnnt2
Mouse Description:
troponin T2, cardiac Gene [Source:MGI Symbol;Acc:MGI:104597]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24250 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32424 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067351   None 264 None 13
ENSDART00000102766   None 261 None 13
ENSDART00000124951 Essential Splice Site 32 282 3 14
Genomic Location (Zv9):
Chromosome 23 (position 5729674)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5745836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGTGGAGGAGGAGGAGGAGGTGCAGGAGGAGGCGCAGAATGATGAAG[G/A]TAGATACTGCTTATCTGCTGAAGATAAATGGCACCACCCTTTCACTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067351 Nonsense 195 264 10 13
ENSDART00000102766 Nonsense 192 261 10 13
ENSDART00000124951 Nonsense 213 282 11 14
Genomic Location (Zv9):
Chromosome 23 (position 5714437)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5730599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAAAGAAACAGACTGAGAGAGAGAAGAAGAAGAAGATTCTCGGTGAT[C/T]GACGCAAACCTCTGGACATTGACAATGCCAATGAATCTGCTCTCAGGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link