pob

Ensembl ID:
ENSDARG00000020607
ZFIN ID:
ZDB-GENE-040426-2904
Description:
Transmembrane protein 111 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXW4]
Human Orthologue:
TMEM111
Human Description:
transmembrane protein 111 [Source:HGNC Symbol;Acc:23999]
Mouse Orthologue:
Tmem111
Mouse Description:
transmembrane protein 111 Gene [Source:MGI Symbol;Acc:MGI:1913337]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12923 Nonsense Available for shipment Available now
sa33938 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025441 Nonsense 71 261 2 8
ENSDART00000129302 Nonsense 71 261 3 9

The following transcripts of ENSDARG00000020607 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 42306549)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42377603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTATCAGGAGCAGAGTTTTACGAGAAAATGGCAAATACATCCCTAAA[C/T]AAGTGAGCCTTCTTMAANCTTTTTTGCATTTTKCTTGCGAWGTGATCRAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025441 Nonsense 168 261 6 8
ENSDART00000129302 Nonsense 168 261 7 9

The following transcripts of ENSDARG00000020607 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 42305882)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42376936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGCTGTCTTTAAATAATCTCCTGGTGTATTAATCTGCAGGGTGAGCT[C/A]AGCATCTTGGTATTTCCTGAATGTCTTTGGTCTCAGGAGTATGTATTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link