grk7a

Ensembl ID:
ENSDARG00000020602
ZFIN ID:
ZDB-GENE-050824-1
Description:
G-protein-coupled receptor kinase 7a [Source:RefSeq peptide;Acc:NP_001027011]
Human Orthologue:
GRK7
Human Description:
G protein-coupled receptor kinase 7 [Source:HGNC Symbol;Acc:17031]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18724 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa12074 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100287 Splice Site, Nonsense 345 549 2 4
ENSDART00000100287 Splice Site, Nonsense 345 549 2 4
Genomic Location:
Chromosome 2 (position 16358336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCTTGGTCTCGCTGTGGAGATTGCTGTTGGGAAGACCATCAGCCAG[A/T]AGGTGAGTTCTTCGTCTCTATGCTGTGATTTGTTCCACTGATGCCACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100287 Splice Site, Nonsense 345 549 2 4
ENSDART00000100287 Splice Site, Nonsense 345 549 2 4
Genomic Location:
Chromosome 2 (position 16358336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCTTGGTCTCGCTGTGGAGATTGCTGTTGGGAAGACCATCAGCCAG[A/T]AGKTGAGTTCTTCGKCTCTATGCTGTGATTTGTTCCACTGAWGCCACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lm4mj0j2