rnf144aa

Ensembl ID:
ENSDARG00000020600
ZFIN ID:
ZDB-GENE-041001-88
Description:
Probable E3 ubiquitin-protein ligase RNF144A-A [Source:UniProtKB/Swiss-Prot;Acc:Q5RFV4]
Human Orthologue:
RNF144A
Human Description:
ring finger protein 144A [Source:HGNC Symbol;Acc:20457]
Mouse Orthologue:
Rnf144a
Mouse Description:
ring finger protein 144A Gene [Source:MGI Symbol;Acc:MGI:1344401]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36469 Nonsense Available for shipment Available now
sa32164 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016053 Nonsense 12 293 1 7
Genomic Location (Zv9):
Chromosome 17 (position 35484612)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35369536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGCGGCAGGCATCATGACCACAGCAAGGTACCGACCTACCTGGGATT[T/A]GGCCCTGGACCCGCTGGTGTCCTGTAAGCTGTGTCTGGGAGAGTTTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016053 Nonsense 207 293 5 7
Genomic Location (Zv9):
Chromosome 17 (position 35462229)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35347153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTACATCGAGCGGGACGAGGGCTGTGCACAGATGATGTGTAAAAACTG[C/A]AAGCACGCTTTCTGCTGGTACTGCCTGGAGTCTCTGGACGTGAGTGCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link