fam73a

Ensembl ID:
ENSDARG00000020596
ZFIN ID:
ZDB-GENE-041010-193
Description:
Protein FAM73A [Source:UniProtKB/Swiss-Prot;Acc:Q5XJS0]
Human Orthologue:
FAM73A
Human Description:
family with sequence similarity 73, member A [Source:HGNC Symbol;Acc:24741]
Mouse Orthologue:
Fam73a
Mouse Description:
family with sequence similarity 73, member A Gene [Source:MGI Symbol;Acc:MGI:1924567]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38312 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010257 Nonsense 69 595 3 16

The following transcripts of ENSDARG00000020596 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 8469066)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8886720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCCTCATCATCATCGCACGACGCTTCAGGAGGAGAAAAGGCAGGAGG[A/T]AAGCCAATTCTCCAGTAGAACAGGAAACATTTGAGTTCCTCACCACCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link