gnl3l

Ensembl ID:
ENSDARG00000020595
ZFIN ID:
ZDB-GENE-040723-1
Description:
guanine nucleotide-binding protein-like 3-like protein [Source:RefSeq peptide;Acc:NP_001002875]
Human Orthologue:
GNL3L
Human Description:
guanine nucleotide binding protein-like 3 (nucleolar)-like [Source:HGNC Symbol;Acc:25553]
Mouse Orthologue:
Gnl3l
Mouse Description:
guanine nucleotide binding protein-like 3 (nucleolar)-like Gene [Source:MGI Symbol;Acc:MGI:2448557]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21915 Nonsense Mutation detected in F1 DNA During 2014
sa11450 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026249 Nonsense 148 565 6 15
Genomic Location:
Chromosome 11 (position 26424040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTCTGGATGCCAGAGACCCTTTAGGCTGCCGCTGTCCACAGGTTGAA[C/T]AGGCTGTTGTCCAAAGTGGAACCAACAAAAAAATTGTACTTGTTCTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026249 Nonsense 462 565 13 15
Genomic Location:
Chromosome 11 (position 26434388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACCTCTGGATTGACACAAGGAGGTCAAGGGGAAGATCTGGCAGAATTG[C/T]AGATGGATGAACCRTTAGRTGACCCTGAACTTCAAGACAARGTTGAATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k48cy6ll