txlnba

Ensembl ID:
ENSDARG00000020594
ZFIN ID:
ZDB-GENE-030131-322
Description:
Novel protein similar to vertebrate muscle derived protein (MDP77) [Source:UniProtKB/TrEMBL;Acc:Q5RI
Human Orthologue:
TXLNB
Human Description:
taxilin beta [Source:HGNC Symbol;Acc:21617]
Mouse Orthologue:
Txlnb
Mouse Description:
taxilin beta Gene [Source:MGI Symbol;Acc:MGI:2671945]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25141 Nonsense Mutation detected in F1 DNA During 2014
sa4115 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076313 Nonsense 41 798 1 9
ENSDART00000143515 Nonsense 43 800 1 9
ENSDART00000146994 Nonsense 43 800 1 9
Genomic Location:
Chromosome 20 (position 36904469)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCGATGGAGGACTTTAGCAGGCAGTTAGAAGATATCATCAACACGTA[T/A]GGGTCGGCGTCCAGTCTCATGCAGGAGCAGATCTCCATCCTGGAGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076313 Nonsense 550 798 9 9
ENSDART00000143515 Nonsense 552 800 9 9
ENSDART00000146994 Nonsense 552 800 9 9
Genomic Location:
Chromosome 20 (position 36874055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTCCCCAACTTGAGTCCATCAAACCARTTGATCAACTGAAATCAACA[C/T]AAGAKGAATCCTCTACCATAAAAGTTACRATCACTGAARAGAAGCCMACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dm7ql5pr