LOC100331283

Ensembl ID:
ENSDARG00000020581
Human Orthologue:
OTOF
Human Description:
otoferlin [Source:HGNC Symbol;Acc:8515]
Mouse Orthologue:
Otof
Mouse Description:
otoferlin Gene [Source:MGI Symbol;Acc:MGI:1891247]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14223 Nonsense Available for shipment Available now
sa17767 Essential Splice Site Available for shipment Available now
sa13068 Nonsense Available for shipment Available now
sa4729 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16297 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Nonsense 540 1801 13 41
Genomic Location:
Chromosome 17 (position 50886668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGAATTATTTCCMCCTGCCGTACTTTGAGAGGAAGCCCTGCATCTA[C/A]ATCTACAGCTGGTGGCAGGACCAACGACGACGACTTTATAATGCTAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Essential Splice Site 825 1801 20 41
Genomic Location:
Chromosome 17 (position 50878952)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAGGACATGGTGTTARTAWAGCTTTGAATTGTTTWGCTGGTTTCTCTC[A/G]GGTACTGAAYGAGACRCTGTGTCCCACATGGGATCAGCTGCTGGTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Nonsense 1042 1801 24 41
Genomic Location:
Chromosome 17 (position 50873067)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCTCCGCTGAACATCCGCGTGGTGGACTGCCRAGCGTTTGGCCGCTA[C/A]ACGCTGGTCGGCTCTCATGCCGTCACAACTCTGCGCAAGTTCATCTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Essential Splice Site 1259 1801 30 41
Genomic Location:
Chromosome 17 (position 50867570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTGGATCAGAATGCAGCTGATGAAGACAGACTCATTGGCAAGTTCAAG[G/A]TCTGTTCACATTTGTTGTCCAAGGAACATATGATCTSACAGGCAGAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Nonsense 1772 1801 41 41
Genomic Location:
Chromosome 17 (position 50850490)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGGCAATCCGCCATCTCGTCTGCAACCAATACAAGTGGCTGGTCATC[A/T]AAATAGTGGTGGCTCTGCTGCTTTTAGCAATGCTGGGCTTGTTTCTGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rzepxdjh