atp2a1

Ensembl ID:
ENSDARG00000020574
ZFIN ID:
ZDB-GENE-020905-1
Description:
ATPase, Ca++ transporting, fast twitch 1 [Source:RefSeq peptide;Acc:NP_001007030]
Human Orthologue:
ATP2A1
Human Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 [Source:HGNC Symbol;Acc:811]
Mouse Orthologue:
Atp2a1
Mouse Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 Gene [Source:MGI Symbol;Acc:MGI:105058]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16659 Essential Splice Site Available for shipment Available now
sa17743 Essential Splice Site Available for shipment Available now
sa8121 Nonsense Mutation detected in F1 DNA During 2014
sa10632 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043932 Essential Splice Site 515 1005 14 24
ENSDART00000129561 Essential Splice Site 515 994 13 24
ENSDART00000134647 None None 103 None 9
ENSDART00000146267 None None 98 None 5
ENSDART00000146979 None None 39 None 3

The following transcripts of ENSDARG00000020574 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 26883443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCTGCAAAGGCCTCCAAGGCTCCTGTTGGAAACAAGATGTTTGTYAAG[G/A]TAAGACCAATCATTTAGTTACCTAGTTAAAATTAATATCTTAACACGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043932 Essential Splice Site 626 1005 16 24
ENSDART00000129561 Essential Splice Site 626 994 15 24
ENSDART00000134647 None None 103 None 9
ENSDART00000146267 None None 98 None 5
ENSDART00000146979 None None 39 None 3

The following transcripts of ENSDARG00000020574 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 26882913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNCCCATTGAGCTGTGCAGGGCTGCTGGCATTCGTGTGATCATGATCACAGG[T/C]AAATCMCTAAACCTGAACCTTAATCTTCAAAAMGCACTGAAACATYATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043932 Nonsense 680 1005 17 24
ENSDART00000129561 Nonsense 680 994 16 24
ENSDART00000134647 None None 103 None 9
ENSDART00000146267 None None 98 None 5
ENSDART00000146979 None None 39 None 3

The following transcripts of ENSDARG00000020574 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 26882609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCCARCAGAGAGAAGCGGTGCGTAAGGCCTGCTGTTACGCTCGTGTT[G/T]AGCCCTCCCACAAGAGCAAGATCGTTGAGTTCCTTCAGGGCTTTGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043932 Nonsense 836 1005 19 24
ENSDART00000129561 Nonsense 836 994 18 24
ENSDART00000134647 None None 103 None 9
ENSDART00000146267 None None 98 None 5
ENSDART00000146979 None None 39 None 3

The following transcripts of ENSDARG00000020574 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 26881824)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTCCCCGCTCCCCCAAAGAGCCYCTTATCTCCGGCTGGCTCTTCTTC[A/T]GATAYCTGGCCATTGGAGGTATGATACTTTTCATTTTTNCTGATTTATTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e7u8pvkn