ddx3

Ensembl ID:
ENSDARG00000020573
ZFIN ID:
ZDB-GENE-030131-1565
Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 3 [Source:RefSeq peptide;Acc:NP_001119895]
Human Orthologues:
DDX3X, DDX3Y
Human Descriptions:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked [Source:HGNC Symbol;Acc:2745]
DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked [Source:HGNC Symbol;Acc:2699]
Mouse Orthologues:
D1Pas1, Ddx3x, Ddx3y
Mouse Descriptions:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked Gene [Source:MGI Symbol;Acc:MGI:1349406]
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked Gene [Source:MGI Symbol;Acc:MGI:103064]
DNA segment, Chr 1, Pasteur Institute 1 Gene [Source:MGI Symbol;Acc:MGI:91842]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13318 Essential Splice Site Available for shipment Available now
sa38750 Nonsense Mutation detected in F1 DNA During 2017
sa21526 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006867 Essential Splice Site 191 709 6 18
ENSDART00000140064   None 110 None 4
Genomic Location (Zv9):
Chromosome 9 (position 34379613)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33535559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAGAGGACTGGTCAAAGCCAATGCCCCCCAATGAGCGTCTGGAACAG[T/C]AAGTGGCTGACCRTTAATCTCACTGTGTATCCTGAGAGAATCCATCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006867 Nonsense 252 709 8 18
ENSDART00000140064   None 110 None 4
Genomic Location (Zv9):
Chromosome 9 (position 34379995)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33535941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAACATCACCCTGAGCCGCTACACGCGTCCTACTCCTGTTCAAAAGTA[T/G]GCAATTCCCATCATCAAGACCAAGAGGGACCTGATGGCCTGTGCACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006867 Nonsense 695 709 18 18
ENSDART00000140064   None 110 None 4
Genomic Location (Zv9):
Chromosome 9 (position 34385414)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33541360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTAGGTGGCTTTGGGAGTTTCGGTGGTGACAGCTATGGGGGCACCTAT[G/T]GAAACTATGGAGGAAACTACACTCAGGTGGACTGGTGGGGCAACTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link