ism1

Ensembl ID:
ENSDARG00000020541
ZFIN ID:
ZDB-GENE-050523-3
Description:
Isthmin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q5EGE1]
Human Orthologue:
ISM1
Human Description:
isthmin 1 homolog (zebrafish) [Source:HGNC Symbol;Acc:16213]
Mouse Orthologue:
Ism1
Mouse Description:
isthmin 1 homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:2442963]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025719 Nonsense 199 415 3 5
Genomic Location:
Chromosome 13 (position 34994744)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTGGAAATGGTAACCARARGCGGACCAGATCGTGCGGTTATGCCTG[C/A]ACTGCCACAGAGTCACGGACATGTGACATGCCCAGCTGTCCAGGTAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pva3ro3c