hacl1

Ensembl ID:
ENSDARG00000020529
ZFIN ID:
ZDB-GENE-040426-2058
Description:
2-hydroxyacyl-CoA lyase 1 [Source:RefSeq peptide;Acc:NP_998250]
Human Orthologue:
HACL1
Human Description:
2-hydroxyacyl-CoA lyase 1 [Source:HGNC Symbol;Acc:17856]
Mouse Orthologue:
Hacl1
Mouse Description:
2-hydroxyacyl-CoA lyase 1 Gene [Source:MGI Symbol;Acc:MGI:1929657]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5889 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39097 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004031 Essential Splice Site 293 568 10 17

The following transcripts of ENSDARG00000020529 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22266298)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20372741
KASP Assay ID:
554-3910.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTTGGCTTTCCACCCAGATTCAGTGCCAATGTAAAGATCATTCAGG[T/G]TAGTTAGAACCTTAACRCTGAGGAAGTTGCTGCAGCATCWCTGTAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004031 Nonsense 399 568 13 17

The following transcripts of ENSDARG00000020529 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22271445)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20377888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCATAGTGAGTGAGGGAGCAAACACTATGGACATCGGCCGCACCATGT[T/A]GCTCAATCACCTCCCTCGGCACAGGTGAGAGACACTATTGGCAGCTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link