exoc6

Ensembl ID:
ENSDARG00000020521
ZFIN ID:
ZDB-GENE-040426-2511
Description:
exocyst complex component 6 [Source:RefSeq peptide;Acc:NP_998465]
Human Orthologue:
EXOC6
Human Description:
exocyst complex component 6 [Source:HGNC Symbol;Acc:23196]
Mouse Orthologue:
Exoc6
Mouse Description:
exocyst complex component 6 Gene [Source:MGI Symbol;Acc:MGI:1351611]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41967 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30956 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35215 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022163 Essential Splice Site 659 708 18 19
ENSDART00000125230 Essential Splice Site 657 810 18 22
ENSDART00000022163 Essential Splice Site 659 708 18 19
ENSDART00000125230 Essential Splice Site 657 810 18 22
Genomic Location (Zv9):
Chromosome 12 (position 9761585)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8969540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCATTAACTTCCTGCGCAGCACCTTCCAGGTCTTCACCCACCTTCCGG[T/A]AAGTTCCACACCATCCTATCCACCAGGAGTCAGTCTCGTCACGGATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022163 Essential Splice Site 659 708 18 19
ENSDART00000125230 Essential Splice Site 657 810 18 22
ENSDART00000022163 Essential Splice Site 659 708 18 19
ENSDART00000125230 Essential Splice Site 657 810 18 22
Genomic Location (Zv9):
Chromosome 12 (position 9761585)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8969540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCATTAACTTCCTGCGCAGCACCTTCCAGGTCTTCACCCACCTTCCGG[T/A]AAGTTCCACACCATCCTATCCACCAGGAGTCAGTCTCGTCACGGATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022163   None 708 None 19
ENSDART00000125230 Essential Splice Site 767 810 21 22
Genomic Location (Zv9):
Chromosome 12 (position 9731036)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8938991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGTACCTGCGGGTGAACCCATCCACTGCGCTAGCACTTTTGGAGAA[G/A]TACGTATCATTTTCTTCTCTTTCAAGTGCAGAAATGTGAAAAACAAACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link