exoc6

Ensembl ID:
ENSDARG00000020521
ZFIN ID:
ZDB-GENE-040426-2511
Description:
exocyst complex component 6 [Source:RefSeq peptide;Acc:NP_998465]
Human Orthologue:
EXOC6
Human Description:
exocyst complex component 6 [Source:HGNC Symbol;Acc:23196]
Mouse Orthologue:
Exoc6
Mouse Description:
exocyst complex component 6 Gene [Source:MGI Symbol;Acc:MGI:1351611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3814 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022163 Nonsense 626 708 18 19
ENSDART00000125230 Nonsense 624 810 18 22
Genomic Location:
Chromosome 12 (position 9761686)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACACTAAACTCAACCAGAAGATCGACGAGTTCATTCAGCTGGCGGATTA[T/A]GAATGGGGAATGGCGGAGTCGGATGGCAGGGCCAGCGGCTACCTCATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bfe1bmqj