h3f3b.1

Ensembl ID:
ENSDARG00000020504
ZFIN IDs:
ZDB-GENE-030131-8175, ZDB-GENE-030131-8175, ZDB-GENE-040426-1928, ZDB-GENE-050417-65, ZDB-GENE-050417-65
Description:
Histone H3.3 [Source:UniProtKB/Swiss-Prot;Acc:Q6PI20]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20118 Nonsense Mutation detected in F1 DNA During 2014
sa20117 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027623 Nonsense 130 136 3 3
ENSDART00000146211 Nonsense 130 136 4 4

The following transcripts of ENSDARG00000020504 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 45814758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGCCAAGAGAGTAACAATCATGCCCAAGGATATCCAGCTTGCAAGG[C/T]GAATCAGAGGAGAGAGGGCTTAATTTTTACTTTTTTTATTTCAACTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027623 Nonsense 132 136 3 3
ENSDART00000146211 Nonsense 132 136 4 4

The following transcripts of ENSDARG00000020504 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 45814752)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGAGAGTAACAATCATGCCCAAGGATATCCAGCTTGCAAGGCGAATC[A/T]GAGGAGAGAGGGCTTAATTTTTACTTTTTTTATTTCAACTTTTAAAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2wu0d7q9