lgi1a

Ensembl ID:
ENSDARG00000020493
ZFIN ID:
ZDB-GENE-030131-1731
Description:
leucine-rich, glioma inactivated 1a [Source:RefSeq peptide;Acc:NP_955921]
Human Orthologue:
LGI1
Human Description:
leucine-rich, glioma inactivated 1 [Source:HGNC Symbol;Acc:6572]
Mouse Orthologue:
Lgi1
Mouse Description:
leucine-rich repeat LGI family, member 1 Gene [Source:MGI Symbol;Acc:MGI:1861691]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18184 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017854 Essential Splice Site 58 537 1 8
Genomic Location:
Chromosome 13 (position 310895)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATACCGGAGCCATACCGAGGAGCTTCCCGCAGGACGTCATCTCACTG[T/A]GAGCTACAGTCACCWGCAATGATCATAATGATGGAGGTAATAGTGGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4v6u44ow