CASKIN1 (2 of 3)

Ensembl ID:
ENSDARG00000020489
Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Human Orthologue:
CASKIN1
Human Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Mouse Orthologue:
Caskin1
Mouse Description:
CASK interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442952]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13391 Essential Splice Site Available for shipment Available now
sa32586 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113289 Essential Splice Site 19 1358 2 33
Genomic Location (Zv9):
Chromosome 1 (position 7085059)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7373968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGATKTTAATGTTGTTWAAGTGGTTGAATCATATTTGTGTGTTTTAC[A/G]GGTTATCTGCCCTGCATCATGCTGCTCTTAATGGAAAYGTGGAGCTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113289 Essential Splice Site 1322 1358 31 33
Genomic Location (Zv9):
Chromosome 1 (position 7051229)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7341615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCAGCTGCTCTGGAAGTCGTGGAGGAAAAGATTAAGAAGGATGACAG[G/A]TACATGAGTGGATGTTTCTAGACATTAAAAACAAATTCTGTTTTTCCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link