lta

Ensembl ID:
ENSDARG00000020483
ZFIN ID:
ZDB-GENE-050601-3
Description:
lymphotoxin alpha [Source:RefSeq peptide;Acc:NP_001019992]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17415 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009127 Nonsense 55 203 3 5
Genomic Location:
Chromosome 15 (position 33973759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATATGTGACATCAATRTAACATTTTAATACTATTTTACAGGACCTCAA[G/T]AAAAGAGARTCCAATTTTCAGGTAAGAATCTAATAGTTATCTGTCTATGW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/94kde0ky