nono

Ensembl ID:
ENSDARG00000020482
ZFIN ID:
ZDB-GENE-030131-713
Description:
non-POU domain-containing octamer-binding protein [Source:RefSeq peptide;Acc:NP_963873]
Human Orthologue:
NONO
Human Description:
non-POU domain containing, octamer-binding [Source:HGNC Symbol;Acc:7871]
Mouse Orthologue:
Nono
Mouse Description:
non-POU-domain-containing, octamer binding protein Gene [Source:MGI Symbol;Acc:MGI:1855692]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20389 Nonsense Available for shipment Available now
sa10208 Nonsense Available for shipment Available now
sa806 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011699 Nonsense 5 441 2 10
ENSDART00000146287 Nonsense 5 261 2 6
Genomic Location (Zv9):
Chromosome 5 (position 24384197)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22097069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAAATCTTTTATTGACTATTCGTGTTTTTAAAAAGATGCAAGGAAAC[A/T]GAGGACCCCGTTCAGAGCAGCAGAATCACGGCCCACAGCGACAGCAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011699 Nonsense 19 441 2 10
ENSDART00000146287 Nonsense 19 261 2 6
Genomic Location (Zv9):
Chromosome 5 (position 24384155)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22097027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAAACAGAGGACCCCGTTCAGAGCAGCARAATCACGGCCCACAGCGA[C/T]AGCAGCCCAACCCCCAACAGGAGCAGCAGAGGAAGCCCACYGGAGCCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011699 Nonsense 304 441 6 10
ENSDART00000146287   None 261 None 6
Genomic Location (Zv9):
Chromosome 5 (position 24380286)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22093158
KASP Assay ID:
554-0711.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAGAGGCTAAAGAGAAGCTGGAGACTGAACTGGAAGCTGCACGGCAT[G/T]AACACCAAGTCATGCTAATGCGACAAGGTGAGTTCTCACTCATTAAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link