hddc3

Ensembl ID:
ENSDARG00000020473
ZFIN ID:
ZDB-GENE-050417-377
Description:
Guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase MESH1 [Source:UniProtKB/Swiss-Prot;Acc:Q568
Human Orthologue:
HDDC3
Human Description:
HD domain containing 3 [Source:HGNC Symbol;Acc:30522]
Mouse Orthologue:
Hddc3
Mouse Description:
HD domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915945]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21061 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032324 Splice Site, Nonsense 57 180 2 4
Genomic Location (Zv9):
Chromosome 7 (position 51853288)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50123524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGAGGATTTTAAGTCATGAGGGTGAAATCACAGATGTCGAAGTCATA[C/T]AAGTGAGTCAGAAATGTGTTTCTGGCTTCTCTGTAAAGTGTTGTCTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link