map3k7

Ensembl ID:: ENSDARG00000020469
ZFIN ID:: ZDB-GENE-041001-135
Description:: mitogen-activated protein kinase kinase kinase 7 [Source:RefSeq peptide;Acc:NP_001018586]
Human Orthologue:: MAP3K7
Human Description:: mitogen-activated protein kinase kinase kinase 7 [Source:HGNC Symbol;Acc:6859]
Mouse Orthologue:: Map3k7
Mouse Description:: mitogen-activated protein kinase kinase kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1346877]

Alleles

There are 3 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa230	Nonsense	Confirmed mutation in F2 line	During 2015
sa23699	Nonsense	Mutation detected in F1 DNA	During 2015
sa4899	Essential Splice Site	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa230
Current Status:: Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000018545	Nonsense	22	562	1	19
ENSDART00000025862	Nonsense	22	551	1	16
ENSDART00000124919		None	211	None	6
ENSDART00000130414	Nonsense	27	602	1	18

Genomic Location:: Chromosome 20 (position 24164723)
KASP Assay ID:: 554-0128.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: GCCGATATGCTGGAAACACCGCCTATGTATCCGTTTGAGGAGATCGATTA[T/A]GTTGATATTGAAGTGGAAGAGGTGAGTGATTTCATATGCGTTCTGTTTAA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa23699
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000018545	Nonsense	355	562	13	19
ENSDART00000025862	Nonsense	371	551	11	16
ENSDART00000124919		None	211	None	6
ENSDART00000130414	Nonsense	377	602	11	18

Genomic Location:: Chromosome 20 (position 24149218)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: TAGAGAGTCTTCCTGGCAGGTCACATTTTCAGCCTTCCTCTGACAGCAAA[C/T]GAATGAGTGTCGAACTCTCCGAATTGGAGCCCAGATTACCCTTTGCTTCT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa4899
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000018545	Essential Splice Site	503	562	18	19
ENSDART00000025862	Essential Splice Site	492	551	15	16
ENSDART00000124919	Essential Splice Site	152	211	5	6
ENSDART00000130414	Essential Splice Site	543	602	17	18

Genomic Location:: Chromosome 20 (position 24138017)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: AGGAATACCTGAAGGTGCAGACAGAGATCGCACTTCTCAAACAGAGAAAG[T/C]AAGTCAGAGGAATATGAATCCRTTCAAATAATCAGCATGTATAATACGAA
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Celiac disease: Multiple common variants for celiac disease influencing immune gene expression. (View Study)
Graves' disease: A genome-wide association study identifies two new risk loci for Graves' disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for MAP3K7

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: