map3k7

Ensembl ID:
ENSDARG00000020469
ZFIN ID:
ZDB-GENE-041001-135
Description:
mitogen-activated protein kinase kinase kinase 7 [Source:RefSeq peptide;Acc:NP_001018586]
Human Orthologue:
MAP3K7
Human Description:
mitogen-activated protein kinase kinase kinase 7 [Source:HGNC Symbol;Acc:6859]
Mouse Orthologue:
Map3k7
Mouse Description:
mitogen-activated protein kinase kinase kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1346877]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa230 Nonsense Confirmed mutation in F2 line During 2016
sa23699 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa230
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018545 Nonsense 22 562 1 19
ENSDART00000025862 Nonsense 22 551 1 16
ENSDART00000124919   None 211 None 6
ENSDART00000130414 Nonsense 27 602 1 18
Genomic Location (Zv9):
Chromosome 20 (position 24164723)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24283524
KASP Assay ID:
554-0128.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGATATGCTGGAAACACCGCCTATGTATCCGTTTGAGGAGATCGATTA[T/A]GTTGATATTGAAGTGGAAGAGGTGAGTGATTTCATATGCGTTCTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018545 Nonsense 355 562 13 19
ENSDART00000025862 Nonsense 371 551 11 16
ENSDART00000124919   None 211 None 6
ENSDART00000130414 Nonsense 377 602 11 18
Genomic Location (Zv9):
Chromosome 20 (position 24149218)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24268019
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGAGTCTTCCTGGCAGGTCACATTTTCAGCCTTCCTCTGACAGCAAA[C/T]GAATGAGTGTCGAACTCTCCGAATTGGAGCCCAGATTACCCTTTGCTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link