map3k7

Ensembl ID:
ENSDARG00000020469
ZFIN ID:
ZDB-GENE-041001-135
Description:
mitogen-activated protein kinase kinase kinase 7 [Source:RefSeq peptide;Acc:NP_001018586]
Human Orthologue:
MAP3K7
Human Description:
mitogen-activated protein kinase kinase kinase 7 [Source:HGNC Symbol;Acc:6859]
Mouse Orthologue:
Map3k7
Mouse Description:
mitogen-activated protein kinase kinase kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1346877]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa230 Nonsense Confirmed mutation in F2 line During 2014
sa23699 Nonsense Mutation detected in F1 DNA During 2014
sa4899 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa230
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018545 Nonsense 22 562 1 19
ENSDART00000025862 Nonsense 22 551 1 16
ENSDART00000124919 None None 211 None 6
ENSDART00000130414 Nonsense 27 602 1 18
Genomic Location:
Chromosome 20 (position 24164723)
KASP Assay ID:
554-0128.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGATATGCTGGAAACACCGCCTATGTATCCGTTTGAGGAGATCGATTA[T/A]GTTGATATTGAAGTGGAAGAGGTGAGTGATTTCATATGCGTTCTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018545 Nonsense 355 562 13 19
ENSDART00000025862 Nonsense 371 551 11 16
ENSDART00000124919 None None 211 None 6
ENSDART00000130414 Nonsense 377 602 11 18
Genomic Location:
Chromosome 20 (position 24149218)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGAGTCTTCCTGGCAGGTCACATTTTCAGCCTTCCTCTGACAGCAAA[C/T]GAATGAGTGTCGAACTCTCCGAATTGGAGCCCAGATTACCCTTTGCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018545 Essential Splice Site 503 562 18 19
ENSDART00000025862 Essential Splice Site 492 551 15 16
ENSDART00000124919 Essential Splice Site 152 211 5 6
ENSDART00000130414 Essential Splice Site 543 602 17 18
Genomic Location:
Chromosome 20 (position 24138017)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAATACCTGAAGGTGCAGACAGAGATCGCACTTCTCAAACAGAGAAAG[T/C]AAGTCAGAGGAATATGAATCCRTTCAAATAATCAGCATGTATAATACGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3xeeskq3