
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
map3k7
- Ensembl ID:
- ENSDARG00000020469
- ZFIN ID:
- ZDB-GENE-041001-135
- Description:
- mitogen-activated protein kinase kinase kinase 7 [Source:RefSeq peptide;Acc:NP_001018586]
- Human Orthologue:
- MAP3K7
- Human Description:
- mitogen-activated protein kinase kinase kinase 7 [Source:HGNC Symbol;Acc:6859]
- Mouse Orthologue:
- Map3k7
- Mouse Description:
- mitogen-activated protein kinase kinase kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1346877]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa230 | Nonsense | Confirmed mutation in F2 line | During 2018 |
sa23699 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa230
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018545 | Nonsense | 22 | 562 | 1 | 19 |
ENSDART00000025862 | Nonsense | 22 | 551 | 1 | 16 |
ENSDART00000124919 | None | 211 | None | 6 | |
ENSDART00000130414 | Nonsense | 27 | 602 | 1 | 18 |
- Genomic Location (Zv9):
- Chromosome 20 (position 24164723)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 24283524 GRCz11 20 24182624 - KASP Assay ID:
- 554-0128.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCGATATGCTGGAAACACCGCCTATGTATCCGTTTGAGGAGATCGATTA[T/A]GTTGATATTGAAGTGGAAGAGGTGAGTGATTTCATATGCGTTCTGTTTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23699
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018545 | Nonsense | 355 | 562 | 13 | 19 |
ENSDART00000025862 | Nonsense | 371 | 551 | 11 | 16 |
ENSDART00000124919 | None | 211 | None | 6 | |
ENSDART00000130414 | Nonsense | 377 | 602 | 11 | 18 |
- Genomic Location (Zv9):
- Chromosome 20 (position 24149218)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 24268019 GRCz11 20 24167119 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGAGAGTCTTCCTGGCAGGTCACATTTTCAGCCTTCCTCTGACAGCAAA[C/T]GAATGAGTGTCGAACTCTCCGAATTGGAGCCCAGATTACCCTTTGCTTCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Celiac disease: Multiple common variants for celiac disease influencing immune gene expression. (View Study)
- Graves' disease: A genome-wide association study identifies two new risk loci for Graves' disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: