safb

Ensembl ID:
ENSDARG00000020467
ZFIN ID:
ZDB-GENE-030131-698
Description:
scaffold attachment factor B2 [Source:RefSeq peptide;Acc:NP_999848]
Human Orthologues:
SAFB, SAFB2
Human Descriptions:
scaffold attachment factor B [Source:HGNC Symbol;Acc:10520]
scaffold attachment factor B2 [Source:HGNC Symbol;Acc:21605]
Mouse Orthologues:
Safb, Safb2
Mouse Descriptions:
scaffold attachment factor B Gene [Source:MGI Symbol;Acc:MGI:2146974]
scaffold attachment factor B2 Gene [Source:MGI Symbol;Acc:MGI:2146808]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32393 Nonsense Available for shipment Available now
sa12825 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017838 Nonsense 542 855 14 21
ENSDART00000127016   None 486 None 12
ENSDART00000129766 Nonsense 575 888 15 22
ENSDART00000130238   None 200 None 6

The following transcripts of ENSDARG00000020467 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 15844751)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15672321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTTTTATTTTATATTTCAGAGCTCTAAGAGTCGTGACCGTAATTCGT[T/A]GAGTAAAGAAAGAAAGGACATTTTGTCATTTGATCAAATCAAAGAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017838 Essential Splice Site 581 855 None 21
ENSDART00000127016   None 486 None 12
ENSDART00000129766 Essential Splice Site 614 888 None 22
ENSDART00000130238   None 200 None 6

The following transcripts of ENSDARG00000020467 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 15844632)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15672202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAAAGGGAACGAGAGATTAGAGAAGTTGAGAGACGCAGAAACTCTGGG[T/C]AACTACAATCACCTTGTCTTGAGTTTGCTWTCCCATCTTCTTCTGATTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link