ewsr1b

Ensembl ID:
ENSDARG00000020465
ZFIN ID:
ZDB-GENE-030131-1600
Description:
Ewing sarcoma breakpoint region 1b [Source:RefSeq peptide;Acc:NP_997795]
Human Orthologue:
EWSR1
Human Description:
Ewing sarcoma breakpoint region 1 [Source:HGNC Symbol;Acc:3508]
Mouse Orthologue:
Ewsr1
Mouse Description:
Ewing sarcoma breakpoint region 1 Gene [Source:MGI Symbol;Acc:MGI:99960]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8638 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2014
sa12846 Nonsense Available for shipment Available now
sa20412 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003998 Essential Splice Site 149 579 6 16
ENSDART00000057248 Splice Site None 436 None 13
ENSDART00000127773 Essential Splice Site 148 578 6 16
ENSDART00000143851 Splice Site None 285 None 8

The following transcripts of ENSDARG00000020465 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26547257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTTAAAAATTTGGTAGCATGTATTCCTTAATGTATTAAATTTTCCTA[G/A]TTACAGTGCAAGCAGCCAGCCGGCCTACAACCAAAKTGCCTATTCGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003998 Nonsense 253 579 7 16
ENSDART00000057248 Nonsense 251 436 7 13
ENSDART00000127773 Nonsense 252 578 7 16
ENSDART00000143851 Nonsense 251 285 7 8

The following transcripts of ENSDARG00000020465 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26546864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACAGCCAGGGTGGCGTGAGYGGAGGTTACCCAGGGTCACAGCGTGGT[G/T]GATACCAGGATGGTGGCCGAGATGGATATGRCCGTGGAGGTCCTCGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003998 Nonsense 500 579 15 16
ENSDART00000057248 Nonsense 357 436 12 13
ENSDART00000127773 Nonsense 499 578 15 16
ENSDART00000143851 None None 285 None 8

The following transcripts of ENSDARG00000020465 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26543131)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATCTCTACTTGTGTCTGAGTTTGTGGTTTAAACTGTGTTTAAGGAGGT[G/T]AACGTGGCAGGGGTGGCATGAGGGGCGGCAGGGGCATGGACCGTGGTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qat10tdd