si:ch211-171h4.3

Ensembl ID:
ENSDARG00000020455
ZFIN ID:
ZDB-GENE-081031-85
Description:
Novel kinase protein [Source:UniProtKB/TrEMBL;Acc:B8JL89]
Human Orthologue:
SBK2
Human Description:
SH3-binding domain kinase family, member 2 [Source:HGNC Symbol;Acc:34416]
Mouse Orthologue:
Sbk2
Mouse Description:
SH3-binding domain kinase family, member 2 Gene [Source:MGI Symbol;Acc:MGI:2685925]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36792 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43239 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004375 Essential Splice Site 118 336 3 4
ENSDART00000145319 Essential Splice Site 118 238 3 4
Genomic Location (Zv9):
Chromosome 19 (position 11042369)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10500908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCAGCCCTGCCTTTATGGTGACCTCTATGATGTCATCGTTCCTGAGG[T/C]ACGTTTCATGCATCTAAACAATGACTGGTCATGATGATTGAAATTAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004375 Nonsense 245 336 4 4
ENSDART00000145319   None 238 None 4
Genomic Location (Zv9):
Chromosome 19 (position 11039031)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10497570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCTGTGGATCCCTGTACGGACAGCTGGGCATTGGGCATTTTAATCTA[T/G]GCCATGCTGATGGGGAGCCTTCCATGGTCTGAGACTGTTAAAGACAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link