tmtc4

Ensembl ID:
ENSDARG00000020447
ZFIN ID:
ZDB-GENE-070912-148
Description:
transmembrane and tetratricopeptide repeat containing 4 [Source:RefSeq peptide;Acc:NP_001166973]
Human Orthologue:
TMTC4
Human Description:
transmembrane and tetratricopeptide repeat containing 4 [Source:HGNC Symbol;Acc:25904]
Mouse Orthologue:
Tmtc4
Mouse Description:
transmembrane and tetratricopeptide repeat containing 4 Gene [Source:MGI Symbol;Acc:MGI:1921050]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14987 Nonsense Available for shipment Available now
sa21512 Nonsense Mutation detected in F1 DNA During 2014
sa21511 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078681 Nonsense 285 739 7 17
ENSDART00000127214 Nonsense 285 739 8 18
ENSDART00000133427 None None 62 None 4
ENSDART00000136838 None None 55 None 3
ENSDART00000142904 Nonsense 285 299 8 8
ENSDART00000146268 None None 32 None 2
Genomic Location:
Chromosome 9 (position 32549326)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTGRCTCTACTCTTTCTTGGTGGTTCCTTACTTATGTACAYGAGATG[G/A]AAAATCATGGGAACTGGACCTCCATCTTTYACMGAGGTGGATAACCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078681 Nonsense 359 739 8 17
ENSDART00000127214 Nonsense 359 739 9 18
ENSDART00000133427 None None 62 None 4
ENSDART00000136838 None None 55 None 3
ENSDART00000142904 None None 299 None 8
ENSDART00000146268 None None 32 None 2
Genomic Location:
Chromosome 9 (position 32545772)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATTAGCTCAGCTGCTGATTGGAGGATCGTCTGGCCTGCTGTGCTGTG[G/A]TTCTGTCTGATTGGCTTGGTGAGCCAAGCTCTGTTCTCACAGGACAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078681 Essential Splice Site 630 739 14 17
ENSDART00000127214 Essential Splice Site 630 739 15 18
ENSDART00000133427 None None 62 None 4
ENSDART00000136838 None None 55 None 3
ENSDART00000142904 None None 299 None 8
ENSDART00000146268 None None 32 None 2
Genomic Location:
Chromosome 9 (position 32540728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCACAGCTTGGCATGGAACAATATGGTCATACTGTTAGACAACACTGG[T/A]AATGTACACCTGATTTTGTTTGTTTGATCAGATTTAAAAGATCAATGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y5ea42qj