si:ch211-192p3.2

Ensembl ID:
ENSDARG00000020395
ZFIN ID:
ZDB-GENE-061207-15
Description:
Novel protein similar to human microtubule associated monoxygenase, calponin and LIM domain containi
Human Orthologue:
MICAL2
Human Description:
microtubule associated monoxygenase, calponin and LIM domain containing 2 [Source:HGNC Symbol;Acc:24
Mouse Orthologue:
Mical2
Mouse Description:
microtubule associated monoxygenase, calponin and LIM domain containing 2 Gene [Source:MGI Symbol;Ac

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24630 Splice Site, Nonsense Available for shipment Available now
sa31109 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109672 Splice Site, Nonsense 198 298 5 8
ENSDART00000139013 Splice Site, Nonsense 198 628 5 13
Genomic Location (Zv9):
Chromosome 25 (position 16587993)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16134537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAGGAGTTCAGTGTTTTTCAGTTTGACCCTGTGTTTGCATTTCAGGG[C/T]AGGGATGGAGGGCTGAGATCCGGCCGGCCGATAATCCTGTCTCCGACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109672 Essential Splice Site 231 298 6 8
ENSDART00000139013 Essential Splice Site 231 628 6 13
Genomic Location (Zv9):
Chromosome 25 (position 16590338)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16136882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGTTTGAGCCAAATCAAGCAAACGTAGCCTAATGTTGTTTCTGCTCC[A/T]GGCTTCAGGAGAAAGGAGTTCAGAGGTAAACTAGCCATCGCCATCACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link