eif4g2a

Ensembl ID:
ENSDARG00000020377
ZFIN ID:
ZDB-GENE-030131-2173
Description:
eukaryotic translation initiation factor 4, gamma 2a [Source:RefSeq peptide;Acc:NP_001014311]
Human Orthologue:
EIF4G2
Human Description:
eukaryotic translation initiation factor 4 gamma, 2 [Source:HGNC Symbol;Acc:3297]
Mouse Orthologue:
Eif4g2
Mouse Description:
eukaryotic translation initiation factor 4, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:109207]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31614 Nonsense Available for shipment Available now
sa34229 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027616 Nonsense 450 891 13 21
Genomic Location (Zv9):
Chromosome 7 (position 67339792)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66418654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGCAAGCTCAGTCTAAGGATATGCCACCACGTTTCACTAAGAAAGGA[C/T]AGCTGAATGCTGATGAGGTAGGAGCACATTTTATTTCACCAACTCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027616 Nonsense 816 891 19 21
Genomic Location (Zv9):
Chromosome 7 (position 67332385)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66426061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAAAAATTCCTGCATGATCATGTGGAGCTGCAAGTCAGTGCTCTCTA[T/A]GCACTGCAAGTCCACTGCAATGCACATGCTTTTCCTAAAGGTATGTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link