EXT1A_DANRE

Ensembl ID:
ENSDARG00000020373
Description:
Exostosin-1a [Source:UniProtKB/Swiss-Prot;Acc:Q5IGR8]
Human Orthologue:
EXT1
Human Description:
exostosin 1 [Source:HGNC Symbol;Acc:3512]
Mouse Orthologue:
Ext1
Mouse Description:
exostoses (multiple) 1 Gene [Source:MGI Symbol;Acc:MGI:894663]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22952 Nonsense Mutation detected in F1 DNA During 2016
sa36257 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2874 Nonsense F2 line generated During 2016
sa36258 Nonsense Mutation detected in F1 DNA During 2016
sa9715 Splice Site, Nonsense Available for shipment Available now
sa4684 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa22952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Nonsense 324 730 2 11
Genomic Location (Zv9):
Chromosome 16 (position 51878640)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48602953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATAAAGAAATGCTGCACAACTCCACATTCTGTCTGGTGCCGAGAGGA[C/T]GACGCCTGGGCTCTTTCCGCTTCCTGGAGGCTCTGCAGGTACACTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Essential Splice Site 336 730 2 11
Genomic Location (Zv9):
Chromosome 16 (position 51878679)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48602992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGAGAGGACGACGCCTGGGCTCTTTCCGCTTCCTGGAGGCTCTGCAG[G/A]TACACTTTTACAGTCCAATTTTGTTGCTAATTACAGGCTGTTACTGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2874
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Nonsense 368 730 3 11
Genomic Location (Zv9):
Chromosome 16 (position 51889184)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48613497
KASP Assay ID:
554-3318.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCTCCGAGATCATCRACTGGCGGACGGCTGCTGTCATCGGGGACGAG[A/T]GACTTCTTCTACAGGTAACACTTCCAGAAAACATCAAAACCCCAAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Nonsense 382 730 4 11
Genomic Location (Zv9):
Chromosome 16 (position 51896275)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48620588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGCTCTCTTCTCTTCGCAGATTCCATCGACAGTTCGCTCCATCCAT[C/T]AAGATCGCATTCTGTCACTCCGGCAGCAGACGCAGTTCCTCTGGGAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Splice Site, Nonsense 528 730 7 11
Genomic Location (Zv9):
Chromosome 16 (position 51901087)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48625400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGCTGGCCTGCTACTTCAGTTCCTGTCATCGTAATCGARGGCGAGAGC[A/T]AGGWRAATCTGCGCCGTCTTTATATTCTCTTATCAAATCAARTGTCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4684
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Essential Splice Site 528 730 7 11
Genomic Location (Zv9):
Chromosome 16 (position 51901091)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48625404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCCTGCTACTTCAGTTCCTGTCATCGTAATCGAGGGCGAGAGCAAGG[T/A]GAATCTGCGCCGTCTTTATATTCTCTTATCAAATCAARTGTCTGGTGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link