fbp1b

Ensembl ID:
ENSDARG00000020364
ZFIN ID:
ZDB-GENE-021206-11
Description:
fructose-1,6-bisphosphatase 1b [Source:RefSeq peptide;Acc:NP_998297]
Human Orthologue:
FBP2
Human Description:
fructose-1,6-bisphosphatase 2 [Source:HGNC Symbol;Acc:3607]
Mouse Orthologue:
Fbp2
Mouse Description:
fructose bisphosphatase 2 Gene [Source:MGI Symbol;Acc:MGI:95491]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7570 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051313 Missense 121 337 3 7

The following transcripts of ENSDARG00000020364 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 37078570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACTTTTTNTTTGTTACCCAGGGCAAATACGTGGTTTGTTTTGACCCTC[T/A]GGATGGCTCTTCAAACATTGACTGCTTAGCGTCTATTGGAACTATTTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g7ewq91j