si:ch211-260g14.3

Ensembl ID:
ENSDARG00000020354
ZFIN ID:
ZDB-GENE-041014-332
Description:
hypothetical protein LOC558036 [Source:RefSeq peptide;Acc:NP_001020669]
Human Orthologue:
LMX1A
Human Description:
LIM homeobox transcription factor 1, alpha [Source:HGNC Symbol;Acc:6653]
Mouse Orthologue:
Lmx1a
Mouse Description:
LIM homeobox transcription factor 1 alpha Gene [Source:MGI Symbol;Acc:MGI:1888519]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9422 Essential Splice Site Available for shipment Available now
sa32304 Nonsense Available for shipment Available now
sa37086 Nonsense Mutation detected in F1 DNA During 2017
sa1653 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa9422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019059 Essential Splice Site 214 366 4 7
ENSDART00000139609 Essential Splice Site 116 147 4 5
ENSDART00000146292 Essential Splice Site 116 118 4 4
Genomic Location (Zv9):
Chromosome 20 (position 33961261)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34033774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATGAAGGTCAGCCTGTGGCTCAGTCTCTGTCTGTTTGTCTATTGTAA[G/T]GTGAGGGAGACTCTGGCAGCAGAGACAGGACTGAGCGTACGAGTCGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019059 Nonsense 227 366 4 7
ENSDART00000139609 Nonsense 129 147 4 5
ENSDART00000146292   None 118 None 4
Genomic Location (Zv9):
Chromosome 20 (position 33961301)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34033814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATTGTAAGGTGAGGGAGACTCTGGCAGCAGAGACAGGACTGAGCGTA[C/T]GAGTCGTTCAGGTCTGGTTCCAGAACCAAAGAGCCAAGGTAACGTGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019059 Nonsense 232 366 4 7
ENSDART00000139609 Nonsense 134 147 4 5
ENSDART00000146292   None 118 None 4
Genomic Location (Zv9):
Chromosome 20 (position 33961318)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34033831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTCTGGCAGCAGAGACAGGACTGAGCGTACGAGTCGTTCAGGTCTG[G/A]TTCCAGAACCAAAGAGCCAAGGTAACGTGATGCCCGCCGACACAGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1653
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019059 Essential Splice Site 321 366 6 7
ENSDART00000139609   None 147 None 5
ENSDART00000146292   None 118 None 4
Genomic Location (Zv9):
Chromosome 20 (position 33964377)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34036890
KASP Assay ID:
554-1593.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGGCCTGACCCCTCCTCAGATGCCCGGAGACCACATGCATCCCTATG[G/A]TATTAAATAACACATTATAGACTCACAGCAATGCTGTGCTGGAAATAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link