clasp2

Ensembl ID:
ENSDARG00000020345
ZFIN ID:
ZDB-GENE-040426-2343
Description:
CLIP-associating protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYW6]
Human Orthologue:
CLASP2
Human Description:
cytoplasmic linker associated protein 2 [Source:HGNC Symbol;Acc:17078]
Mouse Orthologue:
Clasp2
Mouse Description:
CLIP associating protein 2 Gene [Source:MGI Symbol;Acc:MGI:1923749]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36908 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa13291 Nonsense Available for shipment Available now
sa36909 Nonsense Available for shipment Available now
sa16627 Nonsense Available for shipment Available now
sa43337 Nonsense Mutation detected in F1 DNA During 2016
sa36910 Essential Splice Site Mutation detected in F1 DNA During 2016
sa29259 Nonsense Mutation detected in F1 DNA During 2016
sa18570 Essential Splice Site Available for shipment Available now
sa12804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Splice Site, Nonsense 128 1529 4 41
ENSDART00000076668   None 1287 None 35
ENSDART00000102499   None 1288 None 36
ENSDART00000136873 Splice Site, Nonsense 128 1476 4 37
ENSDART00000139109   None 1250 None 30
ENSDART00000144557   None 1288 None 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44303807)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43131575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATATACAATATGAATCAGTTTCACTGTTTTTTCTCTCTTTGTGCAGTA[T/A]GTTTGGGAGAGGCTGTTTCCTGGCTTCAAACACAAAAACTTCCGCAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Nonsense 174 1529 5 41
ENSDART00000076668   None 1287 None 35
ENSDART00000102499   None 1288 None 36
ENSDART00000136873 Nonsense 174 1476 5 37
ENSDART00000139109   None 1250 None 30
ENSDART00000144557   None 1288 None 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44308343)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43136111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATACGGTGCTCAGCCCTTGAGTTTRAGTAAATTTGTTCCACATCTCTG[T/A]TCGCTAACAGGAGACCAAAACCCCCAGGTATGAATCTCTGTCTGTGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Nonsense 360 1529 11 41
ENSDART00000076668 Nonsense 128 1287 6 35
ENSDART00000102499 Nonsense 128 1288 6 36
ENSDART00000136873 Nonsense 360 1476 11 37
ENSDART00000139109 Nonsense 121 1250 4 30
ENSDART00000144557 Nonsense 128 1288 6 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44345869)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43173637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGCTGAAGAAAATCCGATCTCTGCTGGTTGCCGGAGCAACAGACTA[T/A]GATTGTTTCTACCAGCACCTGCGCCTGTTGGATGGCGCCTTCAAGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Nonsense 469 1529 14 41
ENSDART00000076668 Nonsense 237 1287 9 35
ENSDART00000102499 Nonsense 237 1288 9 36
ENSDART00000136873 Nonsense 469 1476 14 37
ENSDART00000139109 Nonsense 230 1250 7 30
ENSDART00000144557 Nonsense 237 1288 9 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44347361)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43175129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGATCTCTTTCTTCTCTCWCCRTCTGTCAGGCGCTGTTATGAGTTCT[T/A]GGATCTKCTGCTGCAGGAATGGCAGACTCACTCTCTAGAGAGGTAAATMA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Nonsense 512 1529 16 41
ENSDART00000076668 Nonsense 280 1287 11 35
ENSDART00000102499 Nonsense 280 1288 11 36
ENSDART00000136873 Nonsense 512 1476 16 37
ENSDART00000139109 Nonsense 273 1250 9 30
ENSDART00000144557 Nonsense 280 1288 11 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44349926)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43177694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTTCTTCATTCTTTAATTGATGTTGTTCTCTTTCGCAGGGCGTACTG[G/A]GGGTTGCGGGCTCATTTCCCCGGGGAGGCGGAGTCTCTGTATAACTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Essential Splice Site 686 1529 21 41
ENSDART00000076668 Essential Splice Site 454 1287 16 35
ENSDART00000102499 Essential Splice Site 454 1288 16 36
ENSDART00000136873   None 1476 None 37
ENSDART00000139109   None 1250 None 30
ENSDART00000144557 Essential Splice Site 454 1288 16 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44365192)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43192960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCCCTTCTCATTGGCTCAGGATCACAGTCTGCTACCCCTGTCGGTGG[T/C]AAGATTTTCGACATCTTTCACTCATTCCTTTAGTCCAGTCTCTGCCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Nonsense 928 1529 28 41
ENSDART00000076668 Nonsense 667 1287 21 35
ENSDART00000102499 Nonsense 667 1288 21 36
ENSDART00000136873 Nonsense 875 1476 24 37
ENSDART00000139109 Nonsense 649 1250 17 30
ENSDART00000144557 Nonsense 667 1288 21 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44376455)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43204223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTGCCTCCGCCAACTGGTCCGAGAGGAAAGAGGGGCTGATGGGATTG[C/T]AGGCGTTGCTGAAAAACCATCGAACTCTTAGGTAAAGCATTCAGAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Essential Splice Site 938 1529 29 41
ENSDART00000076668 Essential Splice Site 677 1287 22 35
ENSDART00000102499 Essential Splice Site 677 1288 22 36
ENSDART00000136873 Essential Splice Site 885 1476 25 37
ENSDART00000139109 Essential Splice Site 659 1250 18 30
ENSDART00000144557 Essential Splice Site 677 1288 22 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44377533)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43205301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAGTGAATGCATGTATKCAAGTTGAATTTGTCCTTWCTCTCTGTTTC[A/T]GTCGTGTTGAGCTGAARAGGCTGTGTGAAATCTTCACCAGGATGTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Nonsense 1003 1529 30 41
ENSDART00000076668 Nonsense 761 1287 24 35
ENSDART00000102499 Nonsense 762 1288 25 36
ENSDART00000136873 Nonsense 950 1476 26 37
ENSDART00000139109 Nonsense 724 1250 19 30
ENSDART00000144557 Nonsense 762 1288 25 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44385111)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43212879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCACACAGCTGCTGAAGAAAATGGGAGCGGATCTGCTCGGCTCAGTA[C/T]AAGCCAAAGTACAGAAAGCCCTGGACGTCACAAGGTATGCTGTTTTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link