clasp2

Ensembl ID:
ENSDARG00000020345
ZFIN ID:
ZDB-GENE-040426-2343
Description:
CLIP-associating protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYW6]
Human Orthologue:
CLASP2
Human Description:
cytoplasmic linker associated protein 2 [Source:HGNC Symbol;Acc:17078]
Mouse Orthologue:
Clasp2
Mouse Description:
CLIP associating protein 2 Gene [Source:MGI Symbol;Acc:MGI:1923749]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13291 Nonsense Available for shipment Available now
sa16627 Nonsense Available for shipment Available now
sa18570 Essential Splice Site Available for shipment Available now
sa12804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Nonsense 174 1529 5 41
ENSDART00000076668 None None 1287 None 35
ENSDART00000102499 None None 1288 None 36
ENSDART00000136873 Nonsense 174 1476 5 37
ENSDART00000139109 None None 1250 None 30
ENSDART00000144557 None None 1288 None 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 44308343)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATACGGTGCTCAGCCCTTGAGTTTRAGTAAATTTGTTCCACATCTCTG[T/A]TCGCTAACAGGAGACCAAAACCCCCAGGTATGAATCTCTGTCTGTGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Nonsense 469 1529 14 41
ENSDART00000076668 Nonsense 237 1287 9 35
ENSDART00000102499 Nonsense 237 1288 9 36
ENSDART00000136873 Nonsense 469 1476 14 37
ENSDART00000139109 Nonsense 230 1250 7 30
ENSDART00000144557 Nonsense 237 1288 9 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 44347361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGATCTCTTTCTTCTCTCWCCRTCTGTCAGGCGCTGTTATGAGTTCT[T/A]GGATCTKCTGCTGCAGGAATGGCAGACTCACTCTCTAGAGAGGTAAATMA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Essential Splice Site 938 1529 29 41
ENSDART00000076668 Essential Splice Site 677 1287 22 35
ENSDART00000102499 Essential Splice Site 677 1288 22 36
ENSDART00000136873 Essential Splice Site 885 1476 25 37
ENSDART00000139109 Essential Splice Site 659 1250 18 30
ENSDART00000144557 Essential Splice Site 677 1288 22 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 44377533)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAGTGAATGCATGTATKCAAGTTGAATTTGTCCTTWCTCTCTGTTTC[A/T]GTCGTGTTGAGCTGAARAGGCTGTGTGAAATCTTCACCAGGATGTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039871 Nonsense 1003 1529 30 41
ENSDART00000076668 Nonsense 761 1287 24 35
ENSDART00000102499 Nonsense 762 1288 25 36
ENSDART00000136873 Nonsense 950 1476 26 37
ENSDART00000139109 Nonsense 724 1250 19 30
ENSDART00000144557 Nonsense 762 1288 25 36

The following transcripts of ENSDARG00000020345 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 44385111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCACACAGCTGCTGAAGAAAATGGGAGCGGATCTGCTCGGCTCAGTA[C/T]AAGCCAAAGTACAGAAAGCCCTGGACGTCACAAGGTATGCTGTTTTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b8msy32p