ptpn11a

Ensembl ID:
ENSDARG00000020334
ZFIN ID:
ZDB-GENE-030131-5911
Description:
tyrosine-protein phosphatase non-receptor type 11 [Source:RefSeq peptide;Acc:NP_956140]
Human Orthologue:
PTPN11
Human Description:
protein tyrosine phosphatase, non-receptor type 11 [Source:HGNC Symbol;Acc:9644]
Mouse Orthologue:
Ptpn11
Mouse Description:
protein tyrosine phosphatase, non-receptor type 11 Gene [Source:MGI Symbol;Acc:MGI:99511]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41576 Nonsense Mutation detected in F1 DNA During 2017
sa10099 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081599 Nonsense 104 594 3 16
Genomic Location (Zv9):
Chromosome 10 (position 3442508)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3434702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAAGAGAAAAACGGAGACGTCATTGAGCTGAAATACCCTCTGAACTG[T/A]GCCGATCCCACCTCCGAGAGGTGAGCACATACATACCTCATTATCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081599 Essential Splice Site 534 594 13 16
Genomic Location (Zv9):
Chromosome 10 (position 3453382)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3445576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MGTACAGCATTATATTGAGACTCTGCAGCGCCGCATAGAGGAGGAGCAGG[T/C]GTGTACACTTACAGTGGGGGAGATAAGTATTGAACACATAACCATTTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link