PLEKHA6

Ensembl ID:
ENSDARG00000020328
Description:
pleckstrin homology domain containing, family A member 6 [Source:HGNC Symbol;Acc:17053]
Human Orthologue:
PLEKHA6
Human Description:
pleckstrin homology domain containing, family A member 6 [Source:HGNC Symbol;Acc:17053]
Mouse Orthologue:
Plekha6
Mouse Description:
pleckstrin homology domain containing, family A member 6 Gene [Source:MGI Symbol;Acc:MGI:2388662]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27777 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41827 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21900 Essential Splice Site Available for shipment Available now
sa41826 Nonsense Mutation detected in F1 DNA During 2017
sa41825 Nonsense Mutation detected in F1 DNA During 2017
sa16827 Nonsense Available for shipment Available now
sa35076 Nonsense Mutation detected in F1 DNA During 2017
sa35075 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032844 Essential Splice Site 40 1149 2 26
Genomic Location (Zv9):
Chromosome 11 (position 24360697)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23173294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGATCCAGACACACCTGGAAGAAAACGGACCTTTGAAAGCCTTGCTG[T/C]GAGTGGACTTTTGTTTATTTGTTAGTAAATATATGGCTAGCTTTATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032844 Essential Splice Site 535 1149 10 26
Genomic Location (Zv9):
Chromosome 11 (position 24309607)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23122204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAAAGTATGTATTTATATATACAAATAAGTGTGTAATTGTTCTTTC[A/T]GTATGATTTCCCTGGAGATCGTCGCTCATACAGCCAAGGAATGTACCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032844 Essential Splice Site 581 1149 11 26
Genomic Location (Zv9):
Chromosome 11 (position 24309150)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23121747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTTAGATGCGCAGCTTCAGAGGAACCTGGAGTACCTTGATCAGCAG[G/A]TAGGAGGTTTGATGCAACAAATATTACAGAGACTCGATACTGATACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032844 Nonsense 627 1149 13 26
Genomic Location (Zv9):
Chromosome 11 (position 24299404)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23112001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGAACAGAATCGACTTTTGAAAGAGCAAGAGACTGTAGTTCATCGTT[T/A]ACGAATGGAAAAGGTATGTTTATTGCTTGCAGGAGCTTCAAAAAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032844 Nonsense 832 1149 18 26
Genomic Location (Zv9):
Chromosome 11 (position 24290185)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23102782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCCTTTCCCCCCTCTGTCCCTCCCCTGCCTTTAGACAGCAATGCCTG[G/A]CAGCGCAGCATGGGCCGCAATTCAGGCATCCACCAGGAAGGCTACAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032844 Nonsense 860 1149 19 26
Genomic Location (Zv9):
Chromosome 11 (position 24288118)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23100715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWTTTTTTTNGCAGGGGGTTACATTTYATATGTTCTTTTCCAGCACAACTA[T/A]AACTCGCAGGGAGAAAAGACMAGTGACTTTGARACAGAGCAAGACAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032844 Nonsense 938 1149 21 26
Genomic Location (Zv9):
Chromosome 11 (position 24286685)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23099282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTGCTGTGTTCCCTGCAGAGGTGAAGTCAAAAATGAGTGTGGAGGAA[C/T]AGAATGAGAGGATACGAAGAAACCAGAGCAGCTCCGTCAGAGACAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032844 Nonsense 1026 1149 22 26
Genomic Location (Zv9):
Chromosome 11 (position 24285064)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23097661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAGACGACAGGTGGAGCCTGAACACTATGATCTGGATCTCAGCAAA[G/T]AGGTAAGAGATCACATGGCAGTGCTGTACATTCCATTATGAACAACTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link