TYK2

Ensembl ID:
ENSDARG00000020326
Description:
tyrosine kinase 2 [Source:HGNC Symbol;Acc:12440]
Human Orthologue:
TYK2
Human Description:
tyrosine kinase 2 [Source:HGNC Symbol;Acc:12440]
Mouse Orthologue:
Tyk2
Mouse Description:
tyrosine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1929470]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13280 Essential Splice Site Available for shipment Available now
sa5732 Essential Splice Site F2 line generated During 2014
sa2092 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa13280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055124 Essential Splice Site 757 1174 14 25
Genomic Location:
Chromosome 3 (position 46562910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAAGCTCAGTGACCCAGGCATTTCTCTGTCAGCTCTATCTCAAGGAG[G/A]TAAGCTCGTGTTGTTATTCTCACGTGCTCTAGATCGAATCGAGCACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5732
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055124 Essential Splice Site 892 1174 19 25
ENSDART00000055124 Essential Splice Site 892 1174 19 25
Genomic Location:
Chromosome 3 (position 46574847)
KASP Assay ID:
554-2623.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCGTCTTCTACAAGCGTTACCTGAGGAAGATTCGGGATCTGGGAGAGG[T/C]CAGTTTACCGCCTGTTCTGCGGTCAGCTCTTACTGTCATTTGTCCGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2092
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055124 Essential Splice Site 892 1174 19 25
ENSDART00000055124 Essential Splice Site 892 1174 19 25
Genomic Location:
Chromosome 3 (position 46574847)
KASP Assay ID:
554-2623.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCGTCTTCTACAAGCGTTACCTGAGGAAGATTCGGGATCTGGGAGAGG[T/C]CAGTTTACCGCCTGTTCTGCGGTCAGCTCTTACTGTCATTTGTCCGTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t0y5ay3w