os9

Ensembl ID:
ENSDARG00000020301
ZFIN ID:
ZDB-GENE-060929-32
Description:
protein OS-9 [Source:RefSeq peptide;Acc:NP_001068576]
Human Orthologue:
OS9
Human Description:
osteosarcoma amplified 9, endoplasmic reticulum lectin [Source:HGNC Symbol;Acc:16994]
Mouse Orthologue:
Os9
Mouse Description:
amplified in osteosarcoma Gene [Source:MGI Symbol;Acc:MGI:1924301]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40745 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38566 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113440 Essential Splice Site 123 669 None 15
ENSDART00000133305 Essential Splice Site 157 703 None 15

The following transcripts of ENSDARG00000020301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 39146265)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39217865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATATATTTTGTAGTTACAAAATTAAAATCTTGTTGATCTTTTTTTTTC[A/C]GGCATCTAAGCAGCATAAGCTGAAGAGGTATCACAGTCAGTCATATGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113440 Nonsense 324 669 9 15
ENSDART00000133305 Nonsense 358 703 9 15

The following transcripts of ENSDARG00000020301 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 39141861)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39213461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAACTCTCTTACAGACCCCTCAGGAGCCACAGGACAACCAATTACAT[G/T]AAAATGATTGTAAGACAATTATTTTAATTAAACATAAAGTAACTATGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link