si:ch211-254n4.3

Ensembl ID:
ENSDARG00000020292
ZFIN ID:
ZDB-GENE-081105-89
Description:
family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 [Source:RefSeq peptide;A
Human Orthologues:
FAM19A2, FAM19A4, FAM19A5
Human Descriptions:
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2 [Source:HGNC Symbol;Acc:2
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 [Source:HGNC Symbol;Acc:2
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 [Source:HGNC Symbol;Acc:2
Mouse Orthologues:
Fam19a2, Fam19a4, Fam19a5
Mouse Descriptions:
family with sequence similarity 19, member A2 Gene [Source:MGI Symbol;Acc:MGI:2143691]
family with sequence similarity 19, member A4 Gene [Source:MGI Symbol;Acc:MGI:2444563]
family with sequence similarity 19, member A5 Gene [Source:MGI Symbol;Acc:MGI:2146182]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7139 Nonsense Mutation detected in F1 DNA During 2017
sa8387 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030609 Nonsense 27 132 1 4
ENSDART00000146132 Nonsense 27 132 2 5

The following transcripts of ENSDARG00000020292 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 28283234)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 27411152
KASP Assay ID:
554-4837.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGTGGATCGTACTGGTATTTTTGGCCCTTGTGTTGTTTTGGGGTCATT[T/A]GTCTGAAGCGTCTTCTCACCGCAGTCACATCGGTAAGTCAAGTTCATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030609 Nonsense 54 132 2 4
ENSDART00000146132 Nonsense 54 132 3 5

The following transcripts of ENSDARG00000020292 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 28229769)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 27357687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCACGTGAAAGCTGGCACATGTGAGGTGATTGCAGCCCATCGCTGCWG[T/A]AACAGAAATAAGATTGAGGAGCGATCGCAGACGGTCAAGTGTTCCTGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Pancreatic cancer: Genome-wide association study identifies five loci associated with susceptibility to pancreatic cancer in Chinese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link