pif1

Ensembl ID:
ENSDARG00000020289
ZFIN ID:
ZDB-GENE-030131-4928
Description:
ATP-dependent DNA helicase PIF1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV90]
Human Orthologue:
PIF1
Human Description:
PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26220]
Mouse Orthologue:
Pif1
Mouse Description:
PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2143057]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19721 Essential Splice Site Available for shipment Available now
sa32881 Nonsense Mutation detected in F1 DNA During 2017
sa15503 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006549 Essential Splice Site None 639 None 13

The following transcripts of ENSDARG00000020289 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16935530)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17443066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTACACTACTCTACTAAGTGCTTTAAGCTGCTTTTGTGTTTCTATTGA[A/G]GGGAAGATGCTGGGGCAGATGGAGCCAGCCGAGCTTCAGTGCACAGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006549 Nonsense 183 639 2 13

The following transcripts of ENSDARG00000020289 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16934975)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17442511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAAGTTCTGGGTGACCGCAAACAAGTGAAAAGGCCTAGACCTGATTG[T/A]GATGCTAGCCCGGTATGTTTATCTTTTAATGTATGCCTACATGTTAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006549 Essential Splice Site 480 639 9 13

The following transcripts of ENSDARG00000020289 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16926972)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17434508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTCAGAGTCCAGTGAGTCGACTGCTACAGCTRAAAGTGGGMGCTCAG[G/A]TAGGAGTTTTTTNCCACTTMAGGCAAACACTTACTCCTGATTTTAAAAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link