efcab7

Ensembl ID:
ENSDARG00000020279
ZFIN ID:
ZDB-GENE-040625-115
Description:
EF-hand calcium-binding domain-containing protein 7 [Source:RefSeq peptide;Acc:NP_001002120]
Human Orthologue:
EFCAB7
Human Description:
EF-hand calcium binding domain 7 [Source:HGNC Symbol;Acc:29379]
Mouse Orthologue:
Efcab7
Mouse Description:
EF-hand calcium binding domain 7 Gene [Source:MGI Symbol;Acc:MGI:2385199]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20725 Nonsense Mutation detected in F1 DNA During 2014
sa20724 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016629 Nonsense 528 603 11 13
ENSDART00000139055 Nonsense 531 606 11 13

The following transcripts of ENSDARG00000020279 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 31724532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGCTAAAGCTCTGAAGGGCCATGAGAATGTGCTTGTTTACACATA[C/A]AAAGGAGAGAGCAGGATTTCATCAGTCATTGCTAATAAGGTGGGTTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016629 Nonsense 589 603 13 13
ENSDART00000139055 Nonsense 592 606 13 13

The following transcripts of ENSDARG00000020279 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 31721839)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGGTCTCTGTTTAGGTTTGTCAGCACGTCATGGCTTTAAACGATCAA[C/T]AGGAGTGGACTTACAACTGCACTGAGAGCATTATACCAAGTTTGTAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/15ucvwql