btbd10b

Ensembl ID:
ENSDARG00000020252
ZFIN ID:
ZDB-GENE-080104-5
Description:
Btbd10b protein [Source:UniProtKB/TrEMBL;Acc:Q2YDR4]
Human Orthologue:
BTBD10
Human Description:
BTB (POZ) domain containing 10 [Source:HGNC Symbol;Acc:21445]
Mouse Orthologue:
Btbd10
Mouse Description:
BTB (POZ) domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:1916065]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21126 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011577 Essential Splice Site 225 437 5 7
Genomic Location (Zv9):
Chromosome 7 (position 67934735)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 65892627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTTAATTTAATTACTTCCAGATTTGGCTAATACGCGTTTGTCTGTTC[A/T]GGTGCCCTGATGCATGAGCTGTCGAATGACGGCGCCCGGCGGCAGTTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link