fermt2

Ensembl ID:
ENSDARG00000020242
ZFIN ID:
ZDB-GENE-050506-132
Description:
Fermt2 protein [Source:UniProtKB/TrEMBL;Acc:Q58EF4]
Human Orthologue:
FERMT2
Human Description:
fermitin family member 2 [Source:HGNC Symbol;Acc:15767]
Mouse Orthologue:
Fermt2
Mouse Description:
fermitin family homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2385001]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36538 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049464 Nonsense 663 684 16 16
ENSDART00000085996 Nonsense 663 684 15 15

The following transcripts of ENSDARG00000020242 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 51317576)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50708393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTAAAGTGGTGCACGAGTTCATCGGCGGCTACATCTTCCTGTCCACT[C/T]GAGCCAAGGACCAGAACGAGTCTCTGGACGAGGAGATGTTCTACAAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link