icmt

Ensembl ID:
ENSDARG00000020241
ZFIN ID:
ZDB-GENE-050417-90
Description:
protein-S-isoprenylcysteine O-methyltransferase [Source:RefSeq peptide;Acc:NP_001017618]
Human Orthologue:
ICMT
Human Description:
isoprenylcysteine carboxyl methyltransferase [Source:HGNC Symbol;Acc:5350]
Mouse Orthologue:
Icmt
Mouse Description:
isoprenylcysteine carboxyl methyltransferase Gene [Source:MGI Symbol;Acc:MGI:1888594]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43967 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025487 Nonsense 86 292 2 5
Genomic Location (Zv9):
Chromosome 23 (position 21786923)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21566230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTATATCTTTAGGTGGCTGTTCGAGCCTGCTTTCTTGGATTTACCTTT[G/T]GATGTGGTCTCACTTTAAGTTTTGCAGATACAACATGGACACACTTTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link