NP_001037818.1

Ensembl ID:
ENSDARG00000020239
Description:
phosphatidate phosphatase LPIN1 [Source:RefSeq peptide;Acc:NP_001037818]
Human Orthologue:
LPIN1
Human Description:
lipin 1 [Source:HGNC Symbol;Acc:13345]
Mouse Orthologue:
Lpin1
Mouse Description:
lipin 1 Gene [Source:MGI Symbol;Acc:MGI:1891340]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23110 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104257 Essential Splice Site 772 894 17 20
Genomic Location (Zv9):
Chromosome 17 (position 30525577)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30449504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGACCTGTGCTGCTTAGTCCTAGCAGTCTATTCTCTGCATTTCACAG[G/A]TTGGAATGCATACAAAATGTTTGTAGGTCTTAAAAACCATGTATGGATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link