sept9a

Ensembl ID:
ENSDARG00000020235
ZFIN ID:
ZDB-GENE-030131-9187
Description:
septin-9 [Source:RefSeq peptide;Acc:NP_944593]
Human Orthologue:
SEPT9
Human Description:
septin 9 [Source:HGNC Symbol;Acc:7323]
Mouse Orthologue:
Sept9
Mouse Description:
septin 9 Gene [Source:MGI Symbol;Acc:MGI:1858222]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20066 Nonsense Available for shipment Available now
sa13165 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023039 Nonsense 37 614 1 11
ENSDART00000103061   None 584 None 11
ENSDART00000129313   None 584 None 11
ENSDART00000136221 Nonsense 10 238 1 2
Genomic Location (Zv9):
Chromosome 3 (position 34613491)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34398687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGCGGTGAAGTTGCAGCTATGTTTAAACATCTGAAGCGCGTGAAAT[C/A]AGGTATTTCGAAATGTGGAAATCCAAGAACTCTGTTATTTCATTTAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023039 Nonsense 216 614 2 11
ENSDART00000103061 Nonsense 186 584 2 11
ENSDART00000129313 Nonsense 186 584 2 11
ENSDART00000136221 Nonsense 189 238 2 2
Genomic Location (Zv9):
Chromosome 3 (position 34611389)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34396585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCMGAGCCTCCCAGYCCTCTTGACATCTCCGCTCCATCTAGACGGGCT[G/T]AGATGCACGTTAACAGACAGCTCTCGGACACACAGTCTCCTGCAAGAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Airflow obstruction : Genome-wide association studies identify CHRNA5/3 and HTR4 in the development of airflow obstruction. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link