eif6

Ensembl ID:
ENSDARG00000020232
ZFIN ID:
ZDB-GENE-031118-110
Description:
Eukaryotic translation initiation factor 6 [Source:UniProtKB/Swiss-Prot;Acc:Q6ZM19]
Human Orthologue:
EIF6
Human Description:
eukaryotic translation initiation factor 6 [Source:HGNC Symbol;Acc:6159]
Mouse Orthologue:
Eif6
Mouse Description:
eukaryotic translation initiation factor 6 Gene [Source:MGI Symbol;Acc:MGI:1196288]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14635 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016890 Nonsense 168 245 5 7
ENSDART00000142565   None 129 None 4
ENSDART00000145369   None 149 None 5
Genomic Location (Zv9):
Chromosome 6 (position 52292953)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52342135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTGCTTTCAGTAATCAGGGAGGCCTCGTTCACGCCAAAACATCCATA[G/T]AAGATCAGGACGAGCTCTCGTCACTCCTGCAGGTGCCTTTAGTGGTAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link