dld

Ensembl ID:
ENSDARG00000020219
ZFIN ID:
ZDB-GENE-990415-47
Description:
Delta-like protein D [Source:UniProtKB/Swiss-Prot;Acc:Q8UWJ4]
Human Orthologue:
DLL1
Human Description:
delta-like 1 (Drosophila) [Source:HGNC Symbol;Acc:2908]
Mouse Orthologue:
Dll1
Mouse Description:
delta-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104659]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15390 Nonsense Available for shipment Available now
sa22208 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099224 Nonsense 630 717 9 11
Genomic Location (Zv9):
Chromosome 13 (position 5754253)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5948278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAACATCAACAAGAARGTRGACTTTCAGAGCGACGGCGAMAAAAAC[G/T]GATTCAARTCGCGATACTCGCTAGTGGATTACAATCTTKTTCATGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099224 Nonsense 679 717 9 11
Genomic Location (Zv9):
Chromosome 13 (position 5754105)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5948130
KASP Assay ID:
2260-5986.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGCGAGCCTCTCGATTCCGACTCAGAGGAGAAGCACAGAAATCATT[T/G]AAAAAGGTAAATGAGTGTGAATTTTGGCTAGCGCAGATCCATTTGTCGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link