
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
amfr
- Ensembl ID:
- ENSDARG00000020218
- ZFIN ID:
- ZDB-GENE-040426-2190
- Description:
- autocrine motility factor receptor [Source:RefSeq peptide;Acc:NP_998328]
- Human Orthologue:
- AMFR
- Human Description:
- autocrine motility factor receptor [Source:HGNC Symbol;Acc:463]
- Mouse Orthologue:
- Amfr
- Mouse Description:
- autocrine motility factor receptor Gene [Source:MGI Symbol;Acc:MGI:1345634]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38143 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa1794 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa38143
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012944 | Essential Splice Site | 109 | 620 | 2 | 14 |
ENSDART00000122559 | Essential Splice Site | 109 | 620 | 2 | 13 |
- Genomic Location (Zv9):
- Chromosome 25 (position 37251766)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 35665412 GRCz11 25 36215131 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTGATTCAGTGCATTGTGTTCGGGCCGCTGAGAGTCAGTGAGAAACAGG[T/G]AGGAGAAATTTATAAGCTCACTGATGATTAATGTGCTGCTGTTTTAGGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1794
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012944 | Essential Splice Site | 229 | 620 | 6 | 14 |
ENSDART00000122559 | Essential Splice Site | 229 | 620 | 6 | 13 |
- Genomic Location (Zv9):
- Chromosome 25 (position 37248061)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 35661707 GRCz11 25 36211426 - KASP Assay ID:
- 554-1786.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATGGGTACCATTATATCTAGAATTTGAANGGGTCTGATCTGTTATTTGC[A/T]GGTATTCAATTCACCTGTGGGATCTGAACCATGAGGGAACCTGGGAGAAC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: