amfr

Ensembl ID:
ENSDARG00000020218
ZFIN ID:
ZDB-GENE-040426-2190
Description:
autocrine motility factor receptor [Source:RefSeq peptide;Acc:NP_998328]
Human Orthologue:
AMFR
Human Description:
autocrine motility factor receptor [Source:HGNC Symbol;Acc:463]
Mouse Orthologue:
Amfr
Mouse Description:
autocrine motility factor receptor Gene [Source:MGI Symbol;Acc:MGI:1345634]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38143 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1794 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012944 Essential Splice Site 109 620 2 14
ENSDART00000122559 Essential Splice Site 109 620 2 13
Genomic Location (Zv9):
Chromosome 25 (position 37251766)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35665412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGATTCAGTGCATTGTGTTCGGGCCGCTGAGAGTCAGTGAGAAACAGG[T/G]AGGAGAAATTTATAAGCTCACTGATGATTAATGTGCTGCTGTTTTAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012944 Essential Splice Site 229 620 6 14
ENSDART00000122559 Essential Splice Site 229 620 6 13
Genomic Location (Zv9):
Chromosome 25 (position 37248061)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35661707
KASP Assay ID:
554-1786.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGGTACCATTATATCTAGAATTTGAANGGGTCTGATCTGTTATTTGC[A/T]GGTATTCAATTCACCTGTGGGATCTGAACCATGAGGGAACCTGGGAGAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link