amfr

Ensembl ID:: ENSDARG00000020218
ZFIN ID:: ZDB-GENE-040426-2190
Description:: autocrine motility factor receptor [Source:RefSeq peptide;Acc:NP_998328]
Human Orthologue:: AMFR
Human Description:: autocrine motility factor receptor [Source:HGNC Symbol;Acc:463]
Mouse Orthologue:: Amfr
Mouse Description:: autocrine motility factor receptor Gene [Source:MGI Symbol;Acc:MGI:1345634]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa1794	Essential Splice Site	Available for shipment	Available now

Mutation Details

Allele Name:: sa1794
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: A > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000012944	Essential Splice Site	229	620	6	14
ENSDART00000122559	Essential Splice Site	229	620	6	13

Genomic Location:

Chromosome 25 (position 37248061)

KASP Assay ID:

554-1786.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TATGGGTACCATTATATCTAGAATTTGAANGGGTCTGATCTGTTATTTGC[A/T]GGTATTCAATTCACCTGTGGGATCTGAACCATGAGGGAACCTGGGAGAAC

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

OMIM

OMIM information for AMFR

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: