nar

Ensembl ID:
ENSDARG00000020217
ZFIN ID:
ZDB-GENE-990415-180
Description:
cleavage and polyadenylation specificity factor subunit 4 [Source:RefSeq peptide;Acc:NP_571084]
Human Orthologue:
CPSF4
Human Description:
cleavage and polyadenylation specific factor 4, 30kDa [Source:HGNC Symbol;Acc:2327]
Mouse Orthologue:
Cpsf4
Mouse Description:
cleavage and polyadenylation specific factor 4 Gene [Source:MGI Symbol;Acc:MGI:1861602]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20096 Essential Splice Site Available for shipment Available now
sa760 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa20096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017304 Essential Splice Site 102 271 3 8
Genomic Location (Zv9):
Chromosome 3 (position 40285003)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40148363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGTACGACATGACTAAGATGCCCGAGTGTTATTTCTACTCTAAATTTG[G/A]TTAGTATTGTAATATCCATCCATCCATCTATATTTTGTTTGTTAATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa760
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017304 Essential Splice Site 135 271 4 8
Genomic Location (Zv9):
Chromosome 3 (position 40285179)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40148539
KASP Assay ID:
554-0666.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAAGATTAAAGATTGCCCGTGGTATGATAGGGGTTTTTGTAAACATGG[T/A]AAGTCTTTTGCTATAATTTCCAGATATTGACATACATATACATTCATACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link