nf2a

Ensembl ID:
ENSDARG00000020204
ZFIN ID:
ZDB-GENE-080722-7
Description:
merlin [Source:RefSeq peptide;Acc:NP_001122179]
Human Orthologue:
NF2
Human Description:
neurofibromin 2 (merlin) [Source:HGNC Symbol;Acc:7773]
Mouse Orthologue:
Nf2
Mouse Description:
neurofibromatosis 2 Gene [Source:MGI Symbol;Acc:MGI:97307]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33540 Nonsense Mutation detected in F1 DNA During 2017
sa20351 Nonsense Available for shipment Available now
sa15625 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099617 Nonsense 17 593 1 17
ENSDART00000132564 Nonsense 17 593 2 18
Genomic Location (Zv9):
Chromosome 5 (position 12897105)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11308508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGGCTAGTGCCCTTGCATCAAAAATGGGACTCTCTCTTCGGAGGAAG[C/T]AAGCCAAAATCTTCAATGTTACAGTTGTTACAATGGATGCTGATTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099617 Nonsense 59 593 2 17
ENSDART00000132564 Nonsense 59 593 3 18
Genomic Location (Zv9):
Chromosome 5 (position 12883457)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11294860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGATCTGTTTGAACTTGTATGCCGGACATTGGGGCTCAGGGAGACTT[G/A]GTTTTTTGGTCTGCGGTACGACGTCAAAGACACTGTGGCCTGGCTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099617 Essential Splice Site 577 593 16 17
ENSDART00000132564 Essential Splice Site 577 593 17 18
Genomic Location (Zv9):
Chromosome 5 (position 12827544)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11238947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATGAGAACACGGAGAAAGGCACCAGCAAGCAGAGCAACTTTAAAAAG[G/A]TGGGTTAAATGCATCTCGCACAAAAGCCAGACAATGTGTGATACTTGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link